This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014224


Marker Name:  FCA004 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCTAAGTGCATTTTGGGATGG
Primer: ACTTAACCGACTGAGCCACC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130473

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
247.100 247.100 247.100
Menotti-Raymond, Marilyn et al 1999 (A): A1a Cat
chromosome A1
119.000 119.000 119.000
Murphy et al 2006: E3 Cat
chromosome E3
193.700 193.700 193.700


© The Roslin Institute 2007-2012, all rights reserved