This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014223


Marker Name:  GTF2IRD1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TGTGGCCAGTTATGCAATTC
Primer: GAGGCTGACTGGATGGTGTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AC091543

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
219.000 219.000 219.000
Murphy et al 2006: E3 Cat
chromosome E3
215.700 215.700 215.700


© The Roslin Institute 2007-2012, all rights reserved