This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014216


Marker Name:  MDH2 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: ACGCCAGAAACCTGAGGTAA
Primer: ACGCCAGAAACCTGAGGTAA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
109.300 109.300 109.300
Murphy et al 2006: E3 Cat
chromosome E3
124.700 124.700 124.700


© The Roslin Institute 2007-2012, all rights reserved