This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014212


Marker Name:  GNB2 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AGTACACTGGGGTGGCTCTG
Primer: AGTACACTGGGGTGGCTCTG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
40.000 40.000 40.000
Murphy et al 2006: E3 Cat
chromosome E3
81.600 81.600 81.600


© The Roslin Institute 2007-2012, all rights reserved