This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014200


Marker Name:  Fc.4288 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GGCAGGATTCTTTGAGTTGC
Primer: CCAGCTGGACCCTAAGGACT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646932

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
510.300 510.300 510.300
Murphy et al 2006: E2 Cat
chromosome E2
429.800 429.800 429.800


© The Roslin Institute 2007-2012, all rights reserved