This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014199


Marker Name:  FCA1004 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: ACCTTCTCTGACCTCTCCTGC
Primer: GAGCAAGGCAAGACCTTCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434985

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
493.200 493.200 493.200
Murphy et al 2006: E2 Cat
chromosome E2
394.700 394.700 394.700


© The Roslin Institute 2007-2012, all rights reserved