This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014192


Marker Name:  FCA1000 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: ACTGAGCCACCGAGATGC
Primer: TTCTGGCCAGAGATTTTAGTTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434981

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
303.600 303.600 303.600
Murphy et al 2006: E2 Cat
chromosome E2
161.200 161.200 161.200


© The Roslin Institute 2007-2012, all rights reserved