This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014190


Marker Name:  PSMD8 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TCCTCCCACAAGGAAAAATG
Primer: AAACCTCCTCCCCGACTTAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646929

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
270.000 270.000 270.000
Murphy et al 2006: E2 Cat
chromosome E2
170.200 170.200 170.200


© The Roslin Institute 2007-2012, all rights reserved