This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014187


Marker Name:  FCA998 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCGATCACGTGA
Primer: AGCGACCCTAATTCCAGAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434979

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
194.300 194.300 194.300
Murphy et al 2006: E2 Cat
chromosome E2
123.800 123.800 123.800


© The Roslin Institute 2007-2012, all rights reserved