This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014186


Marker Name:  LOC163223 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GCCCGTCAACTGTGAGTTTT
Primer: ATGTGGGGAGACCTTCAATG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646925

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
190.600 190.600 190.600
Murphy et al 2006: E2 Cat
chromosome E2
116.700 116.700 116.700


© The Roslin Institute 2007-2012, all rights reserved