This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014184


Marker Name:  FCA997 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GTCCCTCACCTTTGTAAACTGC
Primer: GGGTGGCTTAGTGGATTAAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434978

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
184.900 184.900 184.900


© The Roslin Institute 2007-2012, all rights reserved