This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014183


Marker Name:  FCA996 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCAGGACACCCACAGTCAC
Primer: TGCATGAAACCCTGTGATGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434977

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E2 Cat
chromosome E2
161.400 161.400 161.400
Murphy et al 2006: E2 Cat
chromosome E2
133.200 133.200 133.200


© The Roslin Institute 2007-2012, all rights reserved