This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014179


Marker Name:  FCA113 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGGGACGTCATTGCTCCT
Primer: CCCACATTGGGCATAGAAAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130526

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E1 Cat
chromosome E1
1046.300 1046.300 1046.300
Murphy et al 2006: E1 Cat
chromosome E1
1379.800 1379.800 1379.800


© The Roslin Institute 2007-2012, all rights reserved