This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014155


Marker Name:  FCA989 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGTCACTAATCTGCACCAAACC
Primer: CAAGGACTAGCCAGGAGGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434970

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E1 Cat
chromosome E1
237.200 237.200 237.200
Murphy et al 2006: E1 Cat
chromosome E1
672.200 672.200 672.200


© The Roslin Institute 2007-2012, all rights reserved