This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014139


Marker Name:  FCA985 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTGTCCTCAGAGAAGGTGCC
Primer: GCCTTTCTTTGTTTTCTTGGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434966

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
969.700 969.700 969.700
Murphy et al 2006: D4 Cat
chromosome D4
762.100 762.100 762.100


© The Roslin Institute 2007-2012, all rights reserved