This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014128


Marker Name:  PAEP 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GAGAGGATGACACCCCTTCC
Primer: AGGGGCTCAGAGCAGGAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF073785

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
680.400 680.400 680.400
Murphy et al 2006: D4 Cat
chromosome D4
1184.900 1184.900 1184.900


© The Roslin Institute 2007-2012, all rights reserved