This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014125


Marker Name:  PTGDS 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CCCTGCTCTGCTCTTTCCT
Primer: GGAGTTTATTCTCAGAGCCAGGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: D82048

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
628.800 628.800 628.800
Murphy et al 2006: D4 Cat
chromosome D4
1155.100 1155.100 1155.100


© The Roslin Institute 2007-2012, all rights reserved