This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014124


Marker Name:  FCA981 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCTCCAGTGGGACAGTCAGA
Primer: AGGACAAGTGACGTGTGCAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434962

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
620.200 620.200 620.200
Murphy et al 2006: D4 Cat
chromosome D4
1109.400 1109.400 1109.400


© The Roslin Institute 2007-2012, all rights reserved