This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014121


Marker Name:  FCA978 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCCCTGGTGACCTGACTG
Primer: GAGCAGGCCCTAAGGCTACT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434959

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D4 Cat
chromosome D4
568.400 568.400 568.400
Murphy et al 2006: D4 Cat
chromosome D4
1050.500 1050.500 1050.500


© The Roslin Institute 2007-2012, all rights reserved