This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014103


Marker Name:  FCA969 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GATCGTAGATATGACCACGACG
Primer: CCTTAATAGGGCTGGATGCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434952

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D3 Cat
chromosome D3
1017.200 1017.200 1017.200
Murphy et al 2006: D3 Cat
chromosome D3
994.900 994.900 994.900


© The Roslin Institute 2007-2012, all rights reserved