This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014100


Marker Name:  LAMA1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CAGAAAAGCAAACACCGCTTG
Primer: AGGCAGTTTTGCTTTACGTCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646896

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D3 Cat
chromosome D3
692.400 692.400 692.400
Murphy et al 2006: D3 Cat
chromosome D3
618.700 618.700 618.700


© The Roslin Institute 2007-2012, all rights reserved