This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014072


Marker Name:  TRABID 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AGGAGCAGCAGGAGAAGCTA
Primer: TGTAGCGGTCAAGCCACTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646747

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
737.500 737.500 737.500


© The Roslin Institute 2007-2012, all rights reserved