This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014071


Marker Name:  BUB3 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AGGTCGAGTGGCAGTTGAGT
Primer: AGGTCGAGTGGCAGTTGAGT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
713.700 713.700 713.700
Murphy et al 2006: D2 Cat
chromosome D2
1032.700 1032.700 1032.700


© The Roslin Institute 2007-2012, all rights reserved