This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014070


Marker Name:  LOC119392 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TGTGGCAAATAGATGGAAACA
Primer: TCTGGGCATTTCTGGAAGTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646889

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
690.600 690.600 690.600
Murphy et al 2006: D2 Cat
chromosome D2
790.500 790.500 790.500


© The Roslin Institute 2007-2012, all rights reserved