This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014060


Marker Name:  FCA948 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCCTGGCTTCTGTGAATGC
Primer: GGTGAAGATTTCTTGGCCAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434932

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
371.700 371.700 371.700
Murphy et al 2006: D2 Cat
chromosome D2
442.200 442.200 442.200


© The Roslin Institute 2007-2012, all rights reserved