This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014053


Marker Name:  AP2A2 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CGACTGGGCTGTTTATTTGC
Primer: AGTTTTAATCGCCGAGGATG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646745

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
1415.500 1415.500 1415.500
Murphy et al 2006: D1 Cat
chromosome D1
1377.300 1377.300 1377.300


© The Roslin Institute 2007-2012, all rights reserved