This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014049


Marker Name:  PGA5 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CCAGCTCCAGGAAGCAAC
Primer: CTCCACTGGGAGAAGGGATT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF036953

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
1357.500 1357.500 1357.500
Murphy et al 2006: D1 Cat
chromosome D1
1283.100 1283.100 1283.100


© The Roslin Institute 2007-2012, all rights reserved