This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014047


Marker Name:  Fc.132216 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CTCCAGAACCTCTCCGACTG
Primer: ACTACCACATGGGGCCACT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646878

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
1346.200 1346.200 1346.200


© The Roslin Institute 2007-2012, all rights reserved