This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014014


Marker Name:  FCA925 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTTATCAAACCTTCTGGTTCCG
Primer: ATCTAGTAAACTGGCCTGCTGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434909

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
490.200 490.200 490.200
Murphy et al 2006: D2 Cat
chromosome D2
55.600 55.600 55.600


© The Roslin Institute 2007-2012, all rights reserved