This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014003


Marker Name:  FCA193 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TATCTGGTAAGCCCCTGGG
Primer: CCCTGTTTTTATGCCTCTGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130561

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
215.100 215.100 215.100
Murphy et al 2006: D1 Cat
chromosome D1
275.900 275.900 275.900


© The Roslin Institute 2007-2012, all rights reserved