This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013975


Marker Name:  FCA913 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCTGCCTCCCTGGAACAC
Primer: TGTGACTGCCATAGGCTCTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434897

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
1052.300 1052.300 1052.300
Murphy et al 2006: C2 Cat
chromosome C2
1176.800 1176.800 1176.800


© The Roslin Institute 2007-2012, all rights reserved