This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013973


Marker Name:  IL12A 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GCTGTTACAGGCCCTGAATG
Primer: ATTGATGGTCACTGCACGAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF054605

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
997.500 997.500 997.500
Murphy et al 2006: C2 Cat
chromosome C2
1119.900 1119.900 1119.900


© The Roslin Institute 2007-2012, all rights reserved