This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013970


Marker Name:  BCHE 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GTGAGGCCTTGGATGATGTT
Primer: GCATCACTCCCATCCATTCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF053483

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
958.800 958.800 958.800
Murphy et al 2006: C2 Cat
chromosome C2
1066.300 1066.300 1066.300


© The Roslin Institute 2007-2012, all rights reserved