This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013961


Marker Name:  CD80 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TCTGCAGAACCACTGTATGC
Primer: AAGAGCTAAAGAGGCTACCTCCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U57755

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
584.000 584.000 584.000
Murphy et al 2006: C2 Cat
chromosome C2
621.300 621.300 621.300


© The Roslin Institute 2007-2012, all rights reserved