This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013958


Marker Name:  FCA905 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGACGAAATGGAGAATGTATGC
Primer: CACCATGCCTCTCCATCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434889

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
489.100 489.100 489.100
Murphy et al 2006: C2 Cat
chromosome C2
534.500 534.500 534.500


© The Roslin Institute 2007-2012, all rights reserved