This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013946


Marker Name:  FCA895 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GAGCTAGCAGGGAAGGGG
Primer: CTAGCAGTGCTCCATTTCAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434879

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
211.100 211.100 211.100
Murphy et al 2006: C2 Cat
chromosome C2
204.400 204.400 204.400


© The Roslin Institute 2007-2012, all rights reserved