This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013945


Marker Name:  NCAM2 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TGACCAAAACTATTCCATTGACC
Primer: TGACCAAAACTATTCCATTGACC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
198.800 198.800 198.800
Murphy et al 2006: C2 Cat
chromosome C2
174.400 174.400 174.400


© The Roslin Institute 2007-2012, all rights reserved