This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013943


Marker Name:  APP 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TCCAAGATGCAGCAGAACG
Primer: CTAATGTGTGCACATAAAACAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY011369

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
161.000 161.000 161.000
Murphy et al 2006: C2 Cat
chromosome C2
129.800 129.800 129.800


© The Roslin Institute 2007-2012, all rights reserved