This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013935


Marker Name:  FCA890 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CATGACCTGAGCTGAAACCA
Primer: GGAACGGACCCAGTGATG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434874

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
1874.400 1874.400 1874.400
Murphy et al 2006: C1 Cat
chromosome C1
2010.600 2010.600 2010.600


© The Roslin Institute 2007-2012, all rights reserved