This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013933


Marker Name:  Fc.98104 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GCTCCCTGGCAGATATCCTA
Primer: GGATGCCCCCTATAGTCCTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646867

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
1842.100 1842.100 1842.100
Murphy et al 2006: C1 Cat
chromosome C1
2007.700 2007.700 2007.700


© The Roslin Institute 2007-2012, all rights reserved