This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013927


Marker Name:  CD28 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GCAATGGGACCATTATCCAC
Primer: AAGCACCAAGAGCCACTGTT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U57754

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
1653.400 1653.400 1653.400
Murphy et al 2006: C1 Cat
chromosome C1
1766.200 1766.200 1766.200


© The Roslin Institute 2007-2012, all rights reserved