This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013895


Marker Name:  GJA4 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GCGACGAGCAGTCAGATTTC
Primer: GGTGGGTGTGCTGACAAAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: CC596506

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
431.000 431.000 431.000
Murphy et al 2006: C1 Cat
chromosome C1
382.700 382.700 382.700


© The Roslin Institute 2007-2012, all rights reserved