This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013876


Marker Name:  ENO1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: ATGATCCTCCCCGTTGGT
Primer: GCGTCTTTGCCGTATTTCTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: CC596510

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
83.700 83.700 83.700
Murphy et al 2006: C1 Cat
chromosome C1
70.000 70.000 70.000


© The Roslin Institute 2007-2012, all rights reserved