This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013874


Marker Name:  VAMP3 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CCAGCCAAATGCACAGATAC
Primer: GGCCGTGTCTGACTCTGAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646847

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
44.500 44.500 44.500
Murphy et al 2006: C1 Cat
chromosome C1
39.200 39.200 39.200


© The Roslin Institute 2007-2012, all rights reserved