This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013858


Marker Name:  FCA867 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: ACGTTGCTGTGATACTGCTCC
Primer: CTCCCCCTCTTCCCCTAAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434851

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
926.400 926.400 926.400
Murphy et al 2006: B4 Cat
chromosome B4
1041.300 1041.300 1041.300


© The Roslin Institute 2007-2012, all rights reserved