This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013852


Marker Name:  RPL41 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AGTCCCTTTTGGTCCGTTG
Primer: TTCAGCTAAGACAGCAGAAGAGAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U22229

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
808.700 808.700 808.700
Murphy et al 2006: B4 Cat
chromosome B4
986.600 986.600 986.600


© The Roslin Institute 2007-2012, all rights reserved