This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013851


Marker Name:  HOX3A 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AGCAAGCAACCCATAGTCTACC
Primer: CAGATTTTGATCTGCCTCTCAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M62698

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
791.200 791.200 791.200
Murphy et al 2006: B4 Cat
chromosome B4
911.500 911.500 911.500


© The Roslin Institute 2007-2012, all rights reserved