This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013844


Marker Name:  CD4 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AGTAACCCTTCGGTGCAATG
Primer: AGTGTCTTCTGGCTCTGGGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AB000483

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
461.600 461.600 461.600
Murphy et al 2006: B4 Cat
chromosome B4
478.100 478.100 478.100


© The Roslin Institute 2007-2012, all rights reserved