This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013836


Marker Name:  FCA859 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTGTTATGAGCAATGTTTCCTAGTAT
Primer: CCCTCATTTCCCATCCTTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY434843

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
229.000 229.000 229.000
Murphy et al 2006: B4 Cat
chromosome B4
234.700 234.700 234.700


© The Roslin Institute 2007-2012, all rights reserved