This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00013818


Marker Name:  MAX 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AAGTCCGTGCACTGGAGAAG
Primer: CGGAGCTTCTTCCTGCTTT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: D37786

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
1134.900 1134.900 1134.900
Murphy et al 2006: B3 Cat
chromosome B3
1041.700 1041.700 1041.700


© The Roslin Institute 2007-2012, all rights reserved